Skip to content
CALX
Appearance

Appearance

Light or dark

Colour
Accessibility

CategoriesSearch

DNA primer melting temperature (Tm)

A DNA primer's Tm by the nearest-neighbor thermodynamic model (SantaLucia, 1998), with the empirical formulas for comparison.

Parameters

Primer

Raw or FASTA sequence, typically 15 to 30 bases. Whitespace, line breaks and position numbers are ignored.

Experimental conditions

Melting

two-state model
0½1fraction of strands in duplexC_T = 0.25 µmol/L · [Na⁺] = 50 mmol/Ltwo-state modelat 1 M Na⁺: 77.62 °CTm = 62.74 °Cat 87.61 °C: 7.24 × 10⁻⁸ in duplexsimple estimate½ of strands pairedsalt correction: −14.88 °C6000.050.1temperature (°C)−dθ/dTpeak 63.4 °C0.63 °C above Tm
87.61 °C

Playback only moves the reading temperature, the same input as the handle and the slider: it crosses the whole frame in ten seconds, and every frame is fully recomputed.

−10−7.5−5−2.50ΔH (kcal/mol)ATTGGCCAATTGGCCAATTGGCCGGCCGGCCAATTGGC3’ end
Tm
Tm = ΔH×1000 / (ΔSsalt + R·ln Ceff) = −166×1000 / (−461 + 1.987·ln 6.25 × 10⁻⁸) = 62.74 °C
Salt correction
77.62 °C → 62.74 °C, i.e. −15 °C
Notes (2)

The peak of −dθ/dT, which a thermocycler reads, occurs near θ ≈ 0.42, a few tenths of a degree above Tm.

One bar per consecutive base pair; the terminal and symmetry corrections, which have no position, complete the total.

Result

continuous calculation
Signature quantity
Tm62.74°Cnearest-neighbor model (recommended), 20 bases
Length
20 bases
GC content
60%
Tm, simple estimate
55.88 °C
Gap between the two methods
6.9 °C
Total enthalpy
−165.9 kcal/mol
Total entropy
−440 cal/(mol·K)
Effective concentration
0.0625 µmol/L
Tm at 1 M Na⁺
77.62 °C

Method used · GC-adjusted formula, 64.9 + 41×(GC − 16.4)/N (long sequence)

Calculation, assumptions and sources

Provisional · Physical model · 1 source · reviewed on 1 August 2026

OverviewThe Tm (melting temperature) of a DNA primer is computed with the nearest-neighbor thermodynamic model (SantaLucia, 1998), with ΔH, ΔS, effective concentration and salt correction.

The Tm (melting temperature) of a DNA primer is computed with the nearest-neighbor thermodynamic model (SantaLucia, 1998), with ΔH, ΔS, effective concentration and salt correction. The empirical estimate (Wallace rule or GC-adjusted formula) is given for comparison. An ambiguous IUPAC base rules out the thermodynamic model; the simple estimate then returns a range.

Method & formulasTm(K) = ΔH × 1000 / (ΔS + R·ln(C_eff))
Tm(K) = ΔH × 1000 / (ΔS + R·ln(Ceff))ΔS([Na⁺]) = ΔS(1 M) + 0.368 × (N − 1) × ln([Na⁺])

Following SantaLucia (1998), ΔH and ΔS are summed stack by stack (ten independent parameters), plus an initiation term for each end and a symmetry correction for a self-complementary duplex. C_eff equals the total primer concentration for a self-complementary duplex, a quarter of it for two distinct strands at equal concentration. The salt correction affects only the entropy. The melting curve follows the two-state model, with ΔH and ΔS independent of temperature.

Tm = 2 × (A + T) + 4 × (G + C) (< 14 bases)Tm = 64.9 + 41 × (GC − 16.4) / N (≥ 14 bases)

The Wallace rule, for short oligonucleotides, counts A/T and G/C bases. For longer sequences, the GC-adjusted formula, derived from the GC–Tm relation of Marmur & Doty (1962), uses the number of G/C bases and the length N.

Tm
melting temperature: the temperature at which 50% of duplexes are denatured.
ΔH, ΔS
total enthalpy and entropy of duplex formation, both negative (exothermic pairing), in kcal/mol and cal/(mol·K).
Effective concentration (Ceff)
the concentration used in the Tm equation, set by whether the duplex is self-complementary.
Self-complementary
a strand equal to its reverse complement, which pairs with a copy of itself; not to be confused with a textual palindrome.
GC content
proportion of G and C in the sequence; the Tm rises with it (3 hydrogen bonds for G-C, 2 for A-T).
N
total sequence length, in number of bases.
Wallace rule
empirical rule for short oligos (classic PCR primers), approximate.
AssumptionsOnly monovalent cations (Na⁺/K⁺) are accounted for; magnesium and dNTPs are not corrected for (the Owczarzy et al., 2008 correction is not implemented).
  • Only monovalent cations (Na⁺/K⁺) are accounted for; magnesium and dNTPs are not corrected for (the Owczarzy et al., 2008 correction is not implemented).
  • Both strands are assumed to be at equal concentration; the unequal-concentration variant is not implemented.
Validity domain2 validity limits; the calculation refuses values outside 1 of them

The simple estimate relies only on GC content and length; it ignores base order, primer and salt concentrations, and mismatches. On a panel of reference primers (M13, T7, T3, SP6, gapdh, actb, 16S), the two methods differ by 1 to 2 °C for an 18- to 30-base primer, and by up to 5 °C. At composition extremes, the Wallace rule departs from the thermodynamic model by more than 15 °C for a 100% A/T sequence and by 13 °C for a 100% G/C one.

  • 0.05 ≤ sodium ≤ 1.1model · warning

    The salt correction is calibrated between roughly 0.05 and 1.1 M Na⁺ (SantaLucia, 1998); outside this range, it is extrapolated.

    Instead · Bring the salt concentration closer to the calibrated range, or treat the result as indicative.

  • strand ≥ 0physical · refusal

    Primer concentration cannot be negative or zero.

    Instead · Check the entered concentration value and unit.

ExampleFor the short primer atgcatgcat (10 bases, 4 G/C), the simple estimate gives Tm = 2×6 + 4×4 = 28 °C.

For the short primer atgcatgcat (10 bases, 4 G/C), the simple estimate gives Tm = 2×6 + 4×4 = 28 °C. For a 20-base primer at 50% GC: Tm = 64.9 + 41×(10−16.4)/20 ≈ 51.8 °C.

SourcesSantaLucia, J. · Proceedings of the National Academy of Sciences (PNAS)

  1. SantaLucia, J. · Proceedings of the National Academy of Sciences (PNAS), A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics, PNAS 95(4):1460–1465 (1998), DOI 10.1073/pnas.95.4.1460.

    Location: Table 1 (paramètres ΔH°/ΔS° plus-proche-voisin et termes d’initiation), pages 1460–1463 · accessed 2026-08-01 · DOI 10.1073/pnas.95.4.1460

Scientific validationProvisional, reviewed on 1 August 2026

Scope and limitations

  • The comparison estimate (Wallace rule, GC-adjusted formula) is a heuristic; the choice of formula by primer length has not been verified to the standard of the nearest-neighbor model.

Provisional · Sources and assumptions are provided; the documentary review is incomplete.

Physical model. The result follows the significant figures of the least precise input.

revision 1 · reviewed on 1 August 2026

Revision log

  1. revision 1 · 2026-08-01 · source update

    Ajout de la référence SantaLucia 1998, des hypothèses et du domaine de validité.

    Aucun changement de résultat, les paramètres plus-proche-voisin ne sont pas modifiés.