Skip to content
CALX
Appearance

Appearance

Light or dark

Colour
Accessibility

CategoriesSearch

PCR primer calculator

Analysis and comparison of two PCR primers: length, GC content, Tm, GC clamp, homopolymers, complementarity, dimer and hairpin risk.

Parameters

Both primers

Raw or FASTA sequence. One primer for an individual analysis, both for pair analysis.

Experimental conditions (shared by both primers)

Bench

the pair on its template
Sense strandAntisense strand5′3′3′5′ATGACCGGCAAGCTGATCACTACTGGCCGTTCGACTAGTGCGGAGATCATCAAGACCTGAGCCTCTAGTAGTTCTGGACTamplified region · length unknownForward primer, 5′→3′Reverse primer, 5′→3′
4850525456Tm (°C)Forward primerReverse primer5 °C gapΔTm = 2.1 °C
Forward primer · hairpin, 3 bp stem, 12 bp loop5′3′ATGACACTForward primer · self-dimer, 6 bp run5′3′3′5′ATGACCGGCAAGCTGATCACCACTAGTCGAACGGCCAGTAReverse primer · hairpin, 3 bp stem, 5 bp loop5′3′TCAGCCTCTAGTAGTReverse primer · self-dimer, 4 bp run5′3′3′5′TCAGGTCTTGATGATCTCCGGCCTCTAGTAGTTCTGGACT
Forward primerReverse primers = +10 · 5 bp run5′3′3′ATGACCGGCAAGCTGATCACGCCTCTAGTAGT+8−1001005run (bp)3′: 3 bpbest complementarity: 5 bp6 bp thresholdoffset (nt)best run: 5 bp · forward 15–19 · reverse 12–16
s = +10 · 5 bp run
Tm gap
|53.8 °C − 51.8 °C| = 2.1 °C
Pairings
heterodimer 5 bp · hairpin 3 bp

Result

continuous calculation
Signature quantity
ΔTm2.1 °Cboth Tm within 5 °C of each other

The two Tm differ by 2.1 °C: Tm values compatible · nearest-neighbor Tm values compatible

Pair analysis
Tm gap
2.1 °C
Nearest-neighbor Tm gap
4.3 °C
Heterodimer
5 bp
Heterodimer at 3′
3 bp
Dimer risk
low
Forward primer

ATGACCGGCAAGCTGATCAC

Length
20 nt
GC content
55.0%
Tm, simple estimate
53.8 °C
Nearest-neighbor Tm (recommended)
57.2 °C
Molecular weight
6111.0 g/mol
3' end
C
GC clamp
present
Homopolymer
C×2
Simple repeat
none
Self-dimer
6 bp · moderate
Hairpin
3 bp / 12 nt · moderate
Reverse primer

TCAGGTCTTGATGATCTCCG

Length
20 nt
GC content
50.0%
Tm, simple estimate
51.8 °C
Nearest-neighbor Tm (recommended)
52.9 °C
Molecular weight
6099.0 g/mol
3' end
G
GC clamp
present
Homopolymer
G×2
Simple repeat
"TGA" × 2
Self-dimer
4 bp · low
Hairpin
3 bp / 5 nt · moderate

3' end too GC-rich (more than 3 in the last 5 bases): it can stay annealed despite upstream mismatches and promote mispriming.

Calculation, assumptions and sources

OverviewAnalysis of a forward primer, a reverse primer or both: length, base composition, GC content, melting temperature (SantaLucia 1998 nearest-neighbor model, and the simple estimate), approximate molecular weight, GC clamp, homopolymers and simple repeats.

Analysis of a forward primer, a reverse primer or both: length, base composition, GC content, melting temperature (SantaLucia 1998 nearest-neighbor model, and the simple estimate), approximate molecular weight, GC clamp, homopolymers and simple repeats. For a pair, add the Tm gap, complementarity between primers (global and at a 3' end), self-complementarity and hairpin risk. No automated primer design on a genome.

Method & formulasMW ≈ 313.21×nA + 304.2×nT + 289.18×nC + 329.21×nG − 61.96
MW ≈ 313.21×nA + 304.2×nT + 289.18×nC + 329.21×nG − 61.96

Common approximation for single-stranded DNA with a 5'-OH end (nA, nT, nC, nG: count of each base), not an exact monoisotopic mass.

The polymerase extends the primer from its 3' end. Complementarity touching this end, with the other primer or with itself, can be extended and prime a spurious reaction. Internal complementarity is markedly less problematic.

GC clamp
a G or C base at the terminal 3' position, generally considered favourable to annealing stability.
Tm compatibility
the two primers of a pair work better with close Tm values; a difference of a few degrees is commonly tolerated. A large gap favours preferential amplification of a single strand.
Heterodimer
pairing of the two primers with each other, which consumes them at the expense of the target.
Self-complementarity and hairpin
pairing of a primer with another copy of itself (self-dimer) or folding back on itself (hairpin). The primer becomes partly or fully unavailable to its target.
Tm: thermodynamic model and simple estimateTm is computed with SantaLucia's (1998) nearest-neighbor model, with explicit ΔH and ΔS, and an effective concentration and salt correction shared by both primers.

Tm is computed with SantaLucia's (1998) nearest-neighbor model, with explicit ΔH and ΔS, and an effective concentration and salt correction shared by both primers. The simple estimate (Wallace rule or GC-adjusted formula) is given for comparison. An ambiguous IUPAC base makes the thermodynamic model unavailable for that primer. The model accounts only for monovalent cations (Na⁺/K⁺), not magnesium or dNTPs, and assumes two strands at equal concentration (full assumptions in temperature-fusion-amorce).

Dimers and hairpins: a heuristic analysisComplementarity between primers is detected by a gap-free scan.

Complementarity between primers is detected by a gap-free scan. The “low / moderate / high risk” labels count consecutive matched base pairs and account for their position (a 3' end weighs more). They do not assess thermodynamic stability. A run of 4 G/C pairs is markedly more stable than a run of 6 A/T pairs (ΔG°37 about −3.6 vs −2.9 kcal/mol); a GC-rich match can be underestimated, an AT-rich one overestimated. Primer3 and OligoAnalyzer assess this stability in ΔG. Beyond 300 nucleotides, complementarity and hairpin searches are disabled: they apply to primers, not to a target sequence.